ShortBOL Documentation

This page is the documentation for the standard ShortBOL libary.
Because ShortBOL is based on the SBOL data model it may be useful to explore the SBOL documentation However, don't worry if this looks complicated this is why ShortBOL was created! We try to implement and explain templates that abstract and remove much of this complicated behaviour.

For each Template and Family of Templates, this document explains:
1. What a Template does.
2. Why this template is needed.
3. Where and When to use a template.
4. Any hidden or otherwise unintuative features of details about a Template.

User Mode is essentially a more usable and simple version of the Developer Mode. There is crossover between User and Developer mode but the Documentation below is standalone meaning you do not need to switch between User and Developer Documentation.

Developer Mode

The first layer implemented when ShortBOL was first created. This layer is almost a direct relation with the SBOL data model. This template can be used by users that understand and are happy with a precise but verbose language and that understand the SBOL Data Model well, specifically how different types interact.

MapsTo

Connects parts together that are the same but located in different ModuleDefinitions.

Usage: Given two Instances of ComponentDefinitions(FunctionalComponents) that are present in two different ModuleDefinitions and and a refinment, create MapsTo and add to property mapsTo in the Module.

Parameters

Name	Possible Values	Description
local	- Template	Local FunctionalComponent
remote	- Template	Remote FunctionalComponent
refinement	- i_useRemote - i_useLocal - i_verifyIdentical - i_merge	Relationship between local and remote.

Specialised Components: - MapsUseRemote - MapsUseLocal - MapsIdentical - MapsMerge

Description:
When ComponentDefinition and ModuleDefinition objects are composed into structural and functional hierachies using ComponentInstance and Moduleobjects, it is of ten the case that some ComponentInstance objects are intended to represent the same entity in the overall design. The purpose of the MapsTo class is to make these identity relationships clear and explicit.

Usage Example:

            # MapsTo are used when Modules are defined by create 
# Module Heirachies.
# Maps to are used when a two FunctionalComponents are 
# same entity in the overall design but are located in 
# different ModuleDefinitions.

cas9_generic is a Protein()
gRNA_generic is a SGRNA()
cas9_gRNA_complex is a Complex()
target_gene is a Promoter()


cas9_generic_fc is a InOutComponent(cas9_generic)
gRNA_generic_fc is a InOutComponent(gRNA_generic)
cas9m_BFP_fc is a InOutComponent(cas9_gRNA_complex)
gRNA_b_fc is a InOutComponent(target_gene)

ModuleDef_1 is a ModuleDefinition()
(
    functionalComponent = cas9_generic_fc
    functionalComponent = gRNA_generic_fc
)

cas9m_BFP_map is a MapsUseLocal(cas9m_BFP_fc,cas9_generic_fc)
gRNA_b_map is a MapsTo(gRNA_b_fc,gRNA_generic_fc,i_useLocal)

Template_Module is a Module(ModuleDef_1)
(
    mapsTo = cas9m_BFP_map
    mapsTo = gRNA_b_map
)

ModuleDef_2 is a ModuleDefinition()
(
    functionalComponent = cas9m_BFP_fc
    functionalComponent = gRNA_b_fc

    module = Template_Module
)

ExperimentalData

Aggregate links to experimental data files.

Usage: Aggregates links to experimental data files using the hasAttachment property.

Parameters

Name	Possible Values	Description

Specialised Components:

Description:
An ExperimentalData is typically associated with a single sample, lab instrument, or experimental condition and can be used to describe the output of the test phase of a design-build-test-learn workflow.

Usage Example:

            # Experimental Data is essentially a collection of Attachments
# That are part of a single "thing".
# This examples "thing" is a lab instrument inputs (PCR machine) 
# for a specific experiment using bacillus with an attached robot for automation.

pcr_robot_commands is a Attachment(pcr_commands.csv)
pcr_input is a Attachment(pcr_sample_input.csv)

b_subtilis_pcr_input is a ExperimentalData()
(
  attachment = pcr_robot_commands
  attachment = pcr_input
)

Participation

Participants to an Interaction.

Usage: Given a FunctionalComponent and a participant type add this to the participant property of a Interaction.

Parameters

Name	Possible Values	Description
functionalcomponent	- Template	Participating FunctionalComponent
role	- i_inhibitor - i_inhibited - i_stimulator - i_stimulated - i_modifier - i_modified - i_product - i_reactant - i_participation_promoter - i_template	Describes the behavior of the Participation.

Specialised Components: - Inhibitor - Inhibited - Reactant - Stimulator - Stimulated - Product - ParticipationPromoter - Modifier - Modified - Template

Description:
How a particular FunctionalComponent behaves in its parent Interaction.

Usage Example:

            # The role of FunctionalComponents in
# interactions.
# Any number of Participants can be added to an
# Interaction.

cas9_generic is a Protein()
gRNA_generic is a SGRNA()
LacI is a DNA()

cas9_generic_fc is a InOutComponent(cas9_generic)
gRNA_generic_fc is a InOutComponent(gRNA_generic)
LacI_fc is a InOutComponent(LacI)

cas9_generic_part is a Inhibitor(cas9_generic_fc)
gRNA_generic_part is a Inhibited(gRNA_generic_fc)
LacI_part is a Inhibited(LacI_fc)

cas9_gRNA_int is a Inhibition()
(
	participation = cas9_generic_part
	participation = gRNA_generic_part	
    participation = LacI_part
)

mod is a ModuleDefinition()
(
    functionalComponent = cas9_generic_fc
    functionalComponent = gRNA_generic_fc
    functionalComponent = LacI_fc
    interaction = cas9_gRNA_int
)

ComponentDefinition

The fundemental templates for creation of enitites in a biological design.

Usage: Use to represent parts in a design such as DNA or a Protein.

Parameters

Name	Possible Values	Description
type	- i_DNA - i_DNARegion - i_RNA - i_RNARegion - i_protein - i_smallMolecule - i_complex	Category of the ComponentDefinition such as DNA or Protein.

Specialised Components: - DNAComponent - DNA - RNAComponent - RNA - ProteinComponent - Protein - SmallMoleculeComponent - SmallMolecule - ComplexComponent - Complex - Promoter - RBS - CDS - Terminator - Operator - Gene - EngineeredGene - EngineeredRegion - CDS_RNA - SGRNA - mRNA - TranscriptionFactor - Effector

Description:
These templates create a blueprint of a part, an instances of these are created using FunctionalComponents.

Usage Example:

            # Creates Four Component Definitions,
# It can be noted that the two RBS ComponentDefinitions 
# although written differently are functionally the same.
pTetR is a Promoter()
(
  	description = "pTet promoter"
)

lacI_CDS is a CDS()
lacI_CDS_2 is a ComponentDefinition(i_DNA)
(
    role = i_cds
)

lacI_RBS is a RBS()
lacI_term is a Terminator()

Interaction

How FunctionalComponents interact with one another within a design.

Usage: Given participant templates assign to the interaction properties of ModuleDefinition.

Parameters

Name	Possible Values	Description
type	- i_inhibition - i_stimulation - i_biochemical_reaction - i_noncovalent_bonding - i_degradation - i_genetic_production - i_control	Describes the behavior represented by the Interaction.

Specialised Components: - Inhibition - Stimulation - BiochemicalReaction - NoncovalentBonding - Degradation - GeneticProduction - Control

Description:
A description of how FunctionalComponents within a design interact/work together. Uses Participation objects as an intermediate template to describe the role of each input/output.

Usage Example:

            # Interactions require Participants that
# describe what role FunctionalComponents
# play in the Interaction.

TetR is a ProteinComponent()
LacI is a ProteinComponent()
TetR_fc is a NoneComponent(TetR)
LacI_fc is a NoneComponent(LacI)

LacI_lacinv_part is a Inhibitor(LacI_fc)
TetR_lacinv_part is a Inhibited(TetR_fc)
LacITetR_int is a Inhibition()
(
	participation = TetR_lacinv_part
	participation = LacI_lacinv_part	
)

LacI_inverter is a ModuleDefinition()
(
  functionalComponent = TetR_fc
  functionalComponent = LacI_fc
  interaction = LacITetR_int
)

Range

Regions of a Sequence.

Usage: Given a start and end value create Range and add to location property of a SequenceAnnotation.

Parameters

Name	Possible Values	Description
start	- Integer	integer value stating start of Range on the sequence.
end	- Integer	integer value stating end of Range on the sequence.

Specialised Components: - InlineRange - ReverseComplementRange

Description:
Specifies a region via discrete, inclusive start and end positions that correspond to indices for characters in the elements of a Sequence.

Usage Example:

            # Range can be defined with a Component that has or 
# does not have a Sequence Associated with it.
# Range can only ever be provided to a SequenceAnnotation.
# The two ranges although written differently are functionally identicial.

pTetR is a Promoter()

lacI_RBS_seq is a DNASequence("aaggaggtg")
lacI_RBS is a RBS()
(
  sequence = lacI_RBS_seq
)

pTetR_c is a Component(pTetR)
lacI_RBS_c is a Component(lacI_RBS)

pTetR_range is a InlineRange(1,5)
lacI_RBS_range is a Range(56,57,i_inline)

pTetR_sa is a SequenceAnnotation(pTetR_range)
(
	component = pTetR_c
)
lacI_RBS_sa is a SequenceAnnotation(lacI_RBS_range)
(
	component = lacI_RBS_c
)

tetRInverter is a DNAComponent()
(
  component = pTetR_c
  component = lacI_RBS_c
  sequenceAnnotation = pTetR_sa
  sequenceAnnotation = lacI_RBS_sa
)

Cut

Cut a Sequence.

Usage: Given at value create Cut and add to location property of a SequenceAnnotation.

Parameters

Name	Possible Values	Description
at	- Integer	integer value the location of cut on the sequence.

Specialised Components: - InlineCut - ReverseComplementCut

Description:
Specifies a single point via discrete, integer value indices for characters in the elements of a Sequence.

Usage Example:

            # Cut can be defined with a Component that has or 
# does not have a Sequence Associated with it.
# Cut can only ever be provided to a SequenceAnnotation.
# The two cuts although written differently are functionally identicial.

pTetR is a Promoter()

lacI_RBS_seq is a DNASequence("aaggaggtg")
lacI_RBS is a RBS()
(
  sequence = lacI_RBS_seq
)

pTetR_c is a Component(pTetR)
lacI_RBS_c is a Component(lacI_RBS)

pTetR_cut is a InlineCut(55)
lacI_RBS_cut is a Cut(56,i_inline)

pTetR_sa is a SequenceAnnotation(pTetR_cut)
(
	component = pTetR_c
)

lacI_RBS_sa is a SequenceAnnotation(lacI_RBS_cut)
(
	component = lacI_RBS_c
)

tetRInverter is a DNAComponent()
(
  component = pTetR_c
  component = lacI_RBS_c
  sequenceAnnotation = pTetR_sa
  sequenceAnnotation = lacI_RBS_sa
)

Experiment

Aggregate ExperimentalData.

Usage: Given one or more ExperimentalData objects reference inside this object.

Parameters

Name	Possible Values	Description
member	- Template	Reference to a ExperimentalData object.

Specialised Components:

Description:
Aggregate ExperimentalData objects for subsequent analysis, usually in accordance with an experimental design.

Usage Example:

            # Where ExperimentalData captures a specific "thing" of an Experiment,
# The Experiment template collects there templates for a larger Experiment.

b_subtilis_pcr_input is a ExperimentalData()
b_subtilis_pcr_output is a ExperimentalData()

b_subtilis_pathway_optimisation_test is a Experiment()
(
  experimentalData = b_subtilis_pcr_input
  experimentalData = b_subtilis_pcr_output
)

CombinatorialDerivation

Specify combinatorial biological designs.

Usage: Given an initial Component and one or more Variable components create the template.

Parameters

Name	Possible Values	Description
template	- Template	componeponentDefinition should has SubComponents that can be swapped.

Specialised Components:

Description:
Specify combinatorial biological designs without having to specify every possible design variant. For example, a CombinatorialDerivation can be used to specify a library of reporter gene variants that include different promoters and RBSs without having to specify a Component for every possible combination of promoter, RBS, and CDS in the library.

Usage Example:

            # CombinatorialDerivation uses VariableComponents to create a decoupled libary of potential designs.
# This exampele has a single gene with parts and each part is given as a VariableComponents.
# The CombinatorialDerivation simply requires the Template Component and the VariableComponents
# for the parts that are going to have derivation applied to them.

pTetR is a Promoter()
lacI_RBS is a RBS()
lacI_CDS is a CDS()
lacI_term is a Terminator()

pTetR_sc is a Component(pTetR)
lacI_RBS_sc is a Component(lacI_RBS)
lacI_CDS_sc is a Component(lacI_CDS)
lacI_term_sc is a Component(lacI_term)


promoter_variant_1 is a Promoter()
promoter_variant_2 is a Promoter()
rbs_variant_1 is a RBS()
rbs_variant_2 is a RBS()
cds_variant_1 is a CDS()
cds_variant_2 is a CDS()

tetRInverter is a DNA()
(
  component = pTetR_sc
  component = lacI_RBS_sc
  component = lacI_CDS_sc
  component = lacI_term_sc
)


pTetR_variable is a ZeroOrOneVariableComponent(pTetR_sc)
(
  variant = promoter_variant_1
  variant = promoter_variant_2
)

lacI_RBS_variable is a OneVariableComponent(lacI_RBS_sc)
(
  variant = rbs_variant_1
  variant = rbs_variant_2
)

lacI_CDS_variable is a ZeroPlusVariableComponent(lacI_CDS_sc)
(
  variant = cds_variant_1
  variant = cds_variant_2
)

lacI_term_variable is a OnePlusVariableComponent(lacI_term_sc)


laci_combinatorial_derivation is a CombinatorialDerivation(tetRInverter)
(
  variableComponent = pTetR_variable
  variableComponent = lacI_RBS_variable
  variableComponent = lacI_CDS_variable
  variableComponent = lacI_term_variable
)

Implementation

Represents a realized instance of a ComponentDefinition.

Usage: Given zero or more ComponentDefinition reference them inside the Implementation.

Parameters

Name	Possible Values	Description

Specialised Components:

Description:
Implementation bridges the gap between the SBOL and the realised instance of a "thing". Some Examples DNA resulting from fabricating a genetic design, associated with a laboratory sample that was already built, or that is planned to be built in the future, represent virtual and simulated instances.

Usage Example:

            # Implementation is to define that a ComponentDefinition has been implemented.
# This example states that the laci is the physcial report of the laci dna.

laci_synthesised_seq is a DNASequence("ACCCCTG")
laci_synthesised is a DNA()

laci_implementation is a Implementation()
(
  built = laci_synthesised
)

FunctionalComponent

An instance of a ComponentDefinition being used as part of a ModuleDefinition.

Usage: Given a ComponentDefinition and a direction add this FunctionalComponent to the functionalcomponent property of a ModuleDefinition.

Parameters

Name	Possible Values	Description
componentDefinition	- Template	Blueprint ComponentDefinition
direction	- i_in - i_out - i_inout - i_none	Encode how a designer thinks about the "purpose" of a connection in a system.

Specialised Components: - PrivateFunctionalComponent - InputComponent - OutputComponent - InOutComponent - NoneComponent - InstanceOf

Description:
A FunctionalComponentis an instance of a ComponentDefinition being used as part of a ModuleDefinition. FunctionalComponents can also have directions such as input,output for connections.

Usage Example:

            # FunctionalComponents can be though as 
# Instances of ComponentDefinitions.
# FunctionalComponents only need to be used 
# with designs that has multiple seperate modules.
# (Interaction, ModuleDefinition, Module, MapsTo)

TetR is a ProteinComponent()
LacI is a ProteinComponent()

TetR_fc is a InputComponent(TetR)
LacI_fc is a FunctionalComponent(LacI,i_in)

CRPb_characterization_Circuit is a ModuleDefinition()
(
    functionalComponent = TetR_fc
    functionalComponent = LacI_fc
)

Collection

Group together TopLevel objects

Usage: Requires no parameters but can reference n number of TopLevel objects with the member property.

Parameters

Name	Possible Values	Description

Specialised Components:

Description:
Groups together a set of TopLevel objects that have something in common. For example A set of Component objects representing a library of genetic logic gates.

Usage Example:

            # A Collection is a grouping of TopLevel objects.
# This example shows a collection of genetic logic gates.

AND_gate is a ModuleDefinition()
OR_gate is a ModuleDefinition()
NAND_gate is a ModuleDefinition()
NOR_gate is a ModuleDefinition()
XOR_gate is a ModuleDefinition()

genetic_logic_gates is a Collection()
(
  member = AND_gate
  member = OR_gate
  member = NAND_gate
  member = NOR_gate
  member = XOR_gate
)

Sequence

Structure in Sequence format of parts of a design.

Usage: Given a Sequence in the from of a string ("ATCG" for example") create a instance of a Sequence and add to the sequence property of a ComponentDefinition.

Parameters

Name	Possible Values	Description
elements	- String	Characters that represents the constituents of a biological or chemical molecule
encoding	- i_iupacDNA - i_iupacRNA - i_iupacProtein - i_opensmilesSMILES	URI to indicate how the elements property of a Sequence MUST be formed and interpreted.

Specialised Components: - DNASequence - DNASeq - RNASequence - ProteinSequence - ChemicalStructure - hasDNASeq

Description:
Represent the primary structure of a ComponentDefinition object and the manner in which it is encoded.

Usage Example:

            # Sequences arent only DNA.
# One template can be applied to
# more than one ComponentDefinitions.

pTetR_seq is a DNASequence("tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac")
pTetR is a Promoter()
(
  sequence = pTetR_seq
)

lacI_RBS is a RBS()
(
  sequence = pTetR_seq
)

haemo_seq is a ProteinSequence("AUG")
protein is a Protein()
(
  sequence = haemo_seq
)

SequenceAnnotation

Describes regions of interest on a Sequence.

Usage: Given a Location and optional Component create a SequenceAnnotation and add to a the sequenceAnnotation property of a ComponentDefinition..

Parameters

Name	Possible Values	Description
location	- Template	Location object to indicate which elements of a Sequence are described by the SequenceAnnotation.

Specialised Components: - SA

Description:
A SequenceAnnotation allows the binding of a location to a Component. Uses Location objects as an intermediate template to describe physcial location. This object essentially binds the Sequence to Components

Usage Example:

            # SequenceAnnotations require a location object
# and optional sub-component.
# This allows definition of indication of phyisical location.

pTetR_seq is a DNASequence("tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac")
pTetR is a Promoter()
(
  sequence = pTetR_seq
)

lacI_RBS is a RBS()

pTetR_c is a Component(pTetR)
lacI_RBS_c is a Component(lacI_RBS)

pTetR_loc is a InlineRange(1,55)
lacI_RBS_loc is a InlineRange(56,68)

pTetR_sa is a SequenceAnnotation(pTetR_loc)
(
	component = pTetR_c
)
lacI_RBS_sa is a SequenceAnnotation(lacI_RBS_loc)
(
	component = lacI_RBS_c
)


tetRInverter is a DNAComponent()
(
  component = pTetR_c
  component = lacI_RBS_c
  
  sequenceAnnotation = pTetR_sa
  sequenceAnnotation = lacI_RBS_sa
)

SequenceConstraint

Assert restrictions on the relative, sequence-based positions of pairs ofComponent objects contained by the same parent ComponentDefinition.

Usage: Given a two Component objects and restriction type, create a SequenceConstraint and add to a the sequenceConstraint property of a ComponentDefinition.

Parameters

Name	Possible Values	Description
component	- Template	Subject Component of constraint
component	- Template	Object Component of constraint
restriction	- i_precedes - i_sameOrientationAs - i_oppositeOrientationAs - i_differentFrom	type of restriction places on the ComponentDefinition.

Specialised Components: - Precedes - SameOrientationAs - OppositeOrientationAs - DifferentFrom

Description:
Uses Component objects as an intermediate object because constraints are on the specific instances of a part.

Usage Example:

            # These sequenceConstraints although written
# differently are functionally identical

pTetR is a Promoter()
lacI_RBS is a RBS()

pTetR_c is a Component(pTetR)
lacI_RBS_c is a Component(lacI_RBS)

pair1 is a Precedes(pTetR_c, lacI_RBS_c)
pair2 is a SequenceConstraint(pTetR_c, lacI_RBS_c, i_precedes)

# The composite device for the TetR inverter
tetRInverter is a DNAComponent()
(
  component = pTetR_c
  component = lacI_RBS_c
  # relative positions of child components
  sequenceConstraint = pair1
  sequenceConstraint = pair2
)

Component

compose ComponentDefinition objects into a structural hierarchy.

Usage: Given a ComponentDefinition create Component and add it to component property of ComponentDefinitions, Components or as an input to SequenceAnnotations or SequenceConstraints.

Parameters

Name	Possible Values	Description
componentDefinition	- Template	ComponentDefinition pertaining to sub part.

Specialised Components:

Description:
Example The ComponentDefinition of a gene could contain four Component objects a promoter, RBS, CDS, and terminator. In turn, the ComponentDefinition of the promoter Component could contain Component objects defined as various operator sites.

Usage Example:

            # Example Creates a Component of a ComponentDefinition and
# Adds this to another ComponentDefinition as a sub component.
pTetR is a Promoter()

pTetR_c is a Component(pTetR)

tetRInverter is a DNAComponent()
(
  component = pTetR_c
)

Attachment

A general container for Data.

Usage: Given a source file reference the Attachment in any TopLevel template.

Parameters

Name	Possible Values	Description
source	- URI	a URI reference to the source file.

Specialised Components:

Description:
Serve as a general container for data files, especially experimental data files. It provides a means for linking files and metadata to SBOL designs.

Usage Example:

            # Attachments allow reference to non SBOL data.
# Can be URI's to external or internal resources.

external_attachment is a Attachment(dbvar)
internal_attachment is a Attachment(internal_data)

VariableComponent

A variable that changes during a CombinatorialDerivation.

Usage: Given a Component of the ComponentDefinition that is referenced by the template property reference the VariableComponent by the hasVariableComponent of the Parent CombinatorialDerivation.

Parameters

Name	Possible Values	Description
variable	- Template	A Component to serve as the template for the derivation of the new Component Object
cardinality	- URI	Specifies how many Component objects SHOULD be derived fromthe template Component during the derivation of a new ComponentDefinition.

Specialised Components: - ZeroOrOneVariableComponent - OneVariableComponent - ZeroPlusVariableComponent - OnePlusVariableComponent

Description:
Specifies a variable and set of values that will replace one of the Component objects in the template of a CombinatorialDerivation.

Usage Example:

            # VariableComponents are to be used exclusivley with CombinatorialDerivation.
# This exampele has a single gene with parts and each part is given as a VariableComponents.
# The variants are the alternative build parts in the CombinatorialDerivation.
# These variants can instead be Provided as Collections or other CombinatorialDerivation objects.
# See CombinatorialDerivation for the full example.

pTetR is a Promoter()
lacI_RBS is a RBS()
lacI_CDS is a CDS()
lacI_term is a Terminator()

pTetR_c is a Component(pTetR)
lacI_RBS_c is a Component(lacI_RBS)
lacI_CDS_c is a Component(lacI_CDS)
lacI_term_c is a Component(lacI_term)


promoter_variant_1 is a Promoter()
promoter_variant_2 is a Promoter()
rbs_variant_1 is a RBS()
rbs_variant_2 is a RBS()
cds_variant_1 is a CDS()
cds_variant_2 is a CDS()

tetRInverter is a DNA()
(
  component = pTetR_c
  component = lacI_RBS_c
  component = lacI_CDS_c
  component = lacI_term_c
)


pTetR_variable is a ZeroOrOneVariableComponent(pTetR_c)
(
  variant = promoter_variant_1
  variant = promoter_variant_2
)

lacI_RBS_variable is a OneVariableComponent(lacI_RBS_c)
(
  variant = rbs_variant_1
  variant = rbs_variant_2
)

lacI_CDS_variable is a ZeroPlusVariableComponent(lacI_CDS_c)
(
  variant = cds_variant_1
  variant = cds_variant_2
)

lacI_term_variable is a OnePlusVariableComponent(lacI_term_c)


laci_combinatorial_derivation is a CombinatorialDerivation(tetRInverter)
(
  variableComponent = pTetR_variable
  variableComponent = lacI_RBS_variable
  variableComponent = lacI_CDS_variable
  variableComponent = lacI_term_variable
)

Module

Occurance of a ModuleDefinition.

Usage: Given a ModuleDefinition, create Module and add to module property of the higher level ModuleDefinition.

Parameters

Name	Possible Values	Description
moduleDefinition	- Template	Blueprint ModuleDefinition.

Specialised Components:

Description:
Represents the usage or occurrence of a ModuleDefinition within a larger design (that is, another ModuleDefinition).

Usage Example:

            # Modules add heirachy / abstraction levels to ModuleDefinitions

sub_module_def is a ModuleDefinition()

template_module is a Module(sub_module_def)

module_def is a ModuleDefinition()
(
    module = template_module
)

ModuleDefinition

Group together entities.

Usage: No parameters required, properties are optional and can add any structural or functional enitites.

Parameters

Name	Possible Values	Description

Specialised Components:

Description:
The ModuleDefinition class represents a grouping of structural and functional entities in a biological design. The primary usage of this class is to assert the molecular interactions and abstract function of its child entities.

Usage Example:

            # ModuleDefinitions can hold many
# templates as optional properties.

cas9_generic is a Protein()
gRNA_generic is a SGRNA()

cas9_generic_fc is a InOutComponent(cas9_generic)
gRNA_generic_fc is a InOutComponent(gRNA_generic)

cas9_generic_part is a Inhibitor(cas9_generic_fc)
gRNA_generic_part is a Inhibited(gRNA_generic_fc)
cas9_gRNA_int is a Inhibition()
(
	participation = cas9_generic_part
	participation = gRNA_generic_part	
)

ModuleDef_1 is a ModuleDefinition()
(
    functionalComponent = cas9_generic_fc
    functionalComponent = gRNA_generic_fc
    interaction = cas9_gRNA_int
)

Model

A template to hold external (non sbol_2 model).

Usage: Given a URI to a external model, definition of language and framework assign to the model property of the ModuleDefinition.

Parameters

Name	Possible Values	Description
source	- URI	URI of the external location of the model
language	- i_SBML - i_CellML - i_BioPAX	URI that specifies the language in which the model is implemented
framework	- i_continuous - i_discrete	URI that specifies the framework in which the modei is implemented.

Specialised Components: - SBMLModel - CellMLModel - BioPAXModel

Description:
Provide additional meta-data to enable better reasoning about the contents of this model.

Usage Example:

            # Two models are written differently but 
# functionally identicial.

my_sbml_model is a SBMLModel(sbml_model,i_continuous)
my_sbml_model_2 is a Model(sbml_model,i_SBML,i_continuous)
ModuleDef is a ModuleDefinition()
(
    model = my_sbml_model
    model = my_sbml_model_2
)

User Mode

User Mode allows reduces the knowledge requirement of SBOL and allows quicker and more intuative development of SBOL designs. This means that when you create an instance of these templates, behind the scenes more templates are created. This means that user created ShortBOL should be smaller and more compact and also reduced most knowledge requirement of the SBOL data model. This template is for users that want to utilise the full power of the SBOL data model but want a shorthand and/or simplified way of using the often cumbersome and unnecessarily complicated data model. Note: it is advised to use only the specialised templates for this layer to further increase readability of designs.

mapsTo

Connects parts together that are the same but located in different ModuleDefinitions.

Usage: Given two Instances of ComponentDefinitions(FunctionalComponents) that are present in two different ModuleDefinitions and a refinment, define the mapsTo inside a Module.

Parameters

Name	Possible Values	Description
local	- Template	Local Instance of Compondent Definition
remote	- Template	Remote Instance of Compondent Definition
refinement	- i_useRemote - i_useLocal - i_verifyIdentical - i_merge	Relationship between local and remote.

Specialised Components: - mapsUseRemote - mapsUseLocal - mapsIdentical - mapsMerge

Description:
This template handles the case when there is crossover between ModuleDefinitions. Imagine if two Instances of a ComponentDefinition are present part of two different ModuleDefinitions but they are actually the same things then they should be mapped together.

Usage Example:

            # MapsTo are used when Modules are defined by create 
# Module Heirachies.
# mapsTo can be thought as wiring between functionally
# identical parts in different ModuleDefinitions.

cas9_generic is a Protein()
gRNA_generic is a SGRNA()
cas9_gRNA_complex is a Complex()
target_gene is a Promoter()


cas9_generic_fc is a InstanceOf(cas9_generic)
gRNA_generic_fc is a InstanceOf(gRNA_generic)
cas9m_BFP_fc is a InstanceOf(cas9_gRNA_complex)
gRNA_b_fc is a InstanceOf(target_gene)

ModuleDef_1 is a ModuleDefinition()
(
    functionalComponent = cas9_generic_fc
    functionalComponent = gRNA_generic_fc
)

Template_Module is a Module(ModuleDef_1)
(
    mapsUseLocal(cas9m_BFP_fc, cas9_generic_fc)
    mapsUseLocal(gRNA_b_fc, gRNA_generic_fc)
)

ModuleDef_2 is a ModuleDefinition()
(
    functionalComponent = cas9m_BFP_fc
    functionalComponent = gRNA_b_fc

    module = Template_Module
)

ExperimentalData

Aggregate links to experimental data files.

Usage: Aggregates links to experimental data files using the hasAttachment property.

Parameters

Name	Possible Values	Description

Specialised Components:

Usage Example:

            # Experimental Data is essentially a collection of Attachments
# That are part of a single "thing".
# This examples "thing" is a lab instrument inputs (PCR machine) 
# for a specific experiment using bacillus with an attached robot for automation.

pcr_robot_commands is a Attachment(pcr_commands.csv)
pcr_input is a Attachment(pcr_sample_input.csv)

b_subtilis_pcr_input is a ExperimentalData()
(
  attachment = pcr_robot_commands
  attachment = pcr_input
)

ComponentDefinition

The fundemental templates for creation of enitites in a biological design.

Usage: Use to represent parts in a design such as DNA or a Protein.

Parameters

Name	Possible Values	Description
type	- i_DNA - i_DNARegion - i_RNA - i_RNARegion - i_protein - i_smallMolecule - i_complex	Category of the ComponentDefinition such as DNA or Protein.

Description:
These templates create a blueprint of a part, an instances of these are created using FunctionalComponents.

Usage Example:

            # Creates Four Component Definitions,
# It can be noted that the two RBS ComponentDefinitions 
# although written differently are functionally the same.
pTetR is a Promoter()
(
  	description = "pTet promoter"
)

lacI_CDS is a CDS()
lacI_CDS_2 is a ComponentDefinition(i_DNA)
(
    role = i_cds
)

lacI_RBS is a RBS()
lacI_term is a Terminator()

interaction

How parts interact with one another within a design.

Usage: Given instances Of (functionalComponent) ComponentDefinitions define the interaction inside a ModuleDefinition.

Parameters

Name	Possible Values	Description
functionalComponent	- Template	Instance of the ComponentDefinition that are part of the interactions
type	- Unknown	type of interaction.

Specialised Components:

Description:
a Description of how Instances of parts(ComponentDefinitions) interact with one another within a design. It is espciaially advised to use Specialised Templates here if possible.

Usage Example:

            # Defined inside valid templates.
# Require Instances of ComponentDefinitions.
# Two interactions are functionally identical.

TetR is a ProteinComponent()
LacI is a ProteinComponent()

TetR_fc is a InstanceOf(TetR)
LacI_fc is a InstanceOf(LacI)

# The TetR inverter
TetR_inverter is a ModuleDefinition()
(
  interaction_2(TetR_fc, i_inhibitor, LacI_fc, i_inhibited, i_inhibition)
  inhibition(TetR_fc, LacI_fc)
)

Range

Regions of a Sequence.

Usage: Given a start and end value create Range and add to location property of a SequenceAnnotation.

Parameters

Name	Possible Values	Description
start	- Integer	integer value stating start of Range on the sequence.
end	- Integer	integer value stating end of Range on the sequence.

Specialised Components: - InlineRange - ReverseComplementRange

Description:
Specifies a region via discrete, inclusive start and end positions that correspond to indices for characters in the elements of a Sequence.

Usage Example:

            # Range can be defined with a Component that has or 
# does not have a Sequence Associated with it.
# Range can only ever be provided to a SequenceAnnotation.
# The two ranges although written differently are functionally identicial.

pTetR is a Promoter()

lacI_RBS_seq is a DNASequence("aaggaggtg")
lacI_RBS is a RBS()
(
  sequence = lacI_RBS_seq
)

pTetR_c is a Component(pTetR)
lacI_RBS_c is a Component(lacI_RBS)

pTetR_range is a InlineRange(1,5)
lacI_RBS_range is a Range(56,57,i_inline)

pTetR_sa is a SequenceAnnotation(pTetR_range)
(
	component = pTetR_c
)
lacI_RBS_sa is a SequenceAnnotation(lacI_RBS_range)
(
	component = lacI_RBS_c
)

tetRInverter is a DNAComponent()
(
  component = pTetR_c
  component = lacI_RBS_c
  sequenceAnnotation = pTetR_sa
  sequenceAnnotation = lacI_RBS_sa
)

Cut

Cut a Sequence.

Usage: Given at value create Cut and add to location property of a SequenceAnnotation.

Parameters

Name	Possible Values	Description
at	- Integer	integer value the location of cut on the sequence.

Specialised Components: - InlineCut - ReverseComplementCut

Description:
Specifies a single point via discrete, integer value indices for characters in the elements of a Sequence.

Usage Example:

            # Cut can be defined with a Component that has or 
# does not have a Sequence Associated with it.
# Cut can only ever be provided to a SequenceAnnotation.
# The two cuts although written differently are functionally identicial.

pTetR is a Promoter()

lacI_RBS_seq is a DNASequence("aaggaggtg")
lacI_RBS is a RBS()
(
  sequence = lacI_RBS_seq
)

pTetR_c is a Component(pTetR)
lacI_RBS_c is a Component(lacI_RBS)

pTetR_cut is a InlineCut(55)
lacI_RBS_cut is a Cut(56,i_inline)

pTetR_sa is a SequenceAnnotation(pTetR_cut)
(
	component = pTetR_c
)

lacI_RBS_sa is a SequenceAnnotation(lacI_RBS_cut)
(
	component = lacI_RBS_c
)

tetRInverter is a DNAComponent()
(
  component = pTetR_c
  component = lacI_RBS_c
  sequenceAnnotation = pTetR_sa
  sequenceAnnotation = lacI_RBS_sa
)

Experiment

Aggregate ExperimentalData.

Usage: Given one or more ExperimentalData objects reference inside this object.

Parameters

Name	Possible Values	Description
member	- Template	Reference to a ExperimentalData object.

Specialised Components:

Description:
Aggregate ExperimentalData objects for subsequent analysis, usually in accordance with an experimental design.

Usage Example:

            # Where ExperimentalData captures a specific "thing" of an Experiment,
# The Experiment template collects there templates for a larger Experiment.

b_subtilis_pcr_input is a ExperimentalData()
b_subtilis_pcr_output is a ExperimentalData()

b_subtilis_pathway_optimisation_test is a Experiment()
(
  experimentalData = b_subtilis_pcr_input
  experimentalData = b_subtilis_pcr_output
)

CombinatorialDerivation

Specify combinatorial biological designs.

Usage: Given an initial Component and one or more Variable components create the template.

Parameters

Name	Possible Values	Description
template	- Template	componeponentDefinition should has SubComponents that can be swapped.

Specialised Components:

Usage Example:

            # CombinatorialDerivation uses VariableComponents to create a decoupled libary of potential designs.
# This exampele has a single gene with parts and each part is given as a VariableComponents.
# The CombinatorialDerivation simply requires the Template Component and the VariableComponents
# for the parts that are going to have derivation applied to them.

pTetR is a Promoter()
lacI_RBS is a RBS()
lacI_CDS is a CDS()
lacI_term is a Terminator()

pTetR_sc is a Component(pTetR)
lacI_RBS_sc is a Component(lacI_RBS)
lacI_CDS_sc is a Component(lacI_CDS)
lacI_term_sc is a Component(lacI_term)


promoter_variant_1 is a Promoter()
promoter_variant_2 is a Promoter()
rbs_variant_1 is a RBS()
rbs_variant_2 is a RBS()
cds_variant_1 is a CDS()
cds_variant_2 is a CDS()

tetRInverter is a DNA()
(
  component = pTetR_sc
  component = lacI_RBS_sc
  component = lacI_CDS_sc
  component = lacI_term_sc
)


pTetR_variable is a ZeroOrOneVariableComponent(pTetR_sc)
(
  variant = promoter_variant_1
  variant = promoter_variant_2
)

lacI_RBS_variable is a OneVariableComponent(lacI_RBS_sc)
(
  variant = rbs_variant_1
  variant = rbs_variant_2
)

lacI_CDS_variable is a ZeroPlusVariableComponent(lacI_CDS_sc)
(
  variant = cds_variant_1
  variant = cds_variant_2
)

lacI_term_variable is a OnePlusVariableComponent(lacI_term_sc)


laci_combinatorial_derivation is a CombinatorialDerivation(tetRInverter)
(
  variableComponent = pTetR_variable
  variableComponent = lacI_RBS_variable
  variableComponent = lacI_CDS_variable
  variableComponent = lacI_term_variable
)

Implementation

Represents a realized instance of a ComponentDefinition.

Usage: Given zero or more ComponentDefinition reference them inside the Implementation.

Parameters

Name	Possible Values	Description

Specialised Components:

Usage Example:

            # Implementation is to define that a ComponentDefinition has been implemented.
# This example states that the laci is the physcial report of the laci dna.

laci_synthesised_seq is a DNASequence("ACCCCTG")
laci_synthesised is a DNA()

laci_implementation is a Implementation()
(
  built = laci_synthesised
)

InstanceOf

An instance of a ComponentDefinition being used as part of a ModuleDefinition.

Usage: Given a ComponentDefinition and a direction add this FunctionalComponent to the functionalcomponent property of a ModuleDefinition.

Parameters

Name	Possible Values	Description
componentDefinition	- Template	Blueprint ComponentDefinition
direction	- i_in - i_out - i_inout - i_none	Encode how a designer thinks about the "purpose" of a connection in a system.

Specialised Components: - hasFunctionalComponent - hasPrivateFunctionalComponent - hasInputComponent - hasOutputComponent - hasInOutComponent - hasNoneComponent - instanceOf

Description:
A ComponentDefinition can be thought as a blueprint or a design of a part, this template creates the physical implementation of the ComponentDefinition in the design. InstanceOf only needs to be used when ModuleDefinitions are used.

Usage Example:

            # FunctionalComponents can be though as 
# Instances of ComponentDefinitions.
# FunctionalComponents only need to be used 
# with designs that has multiple seperate modules.
# (Interaction, ModuleDefinition, Module, MapsTo)

TetR is a ProteinComponent()
LacI is a ProteinComponent()

TetR_fc is a InstanceOf(TetR)
LacI_fc is a InstanceOf(LacI)

CRPb_characterization_Circuit is a ModuleDefinition()
(
  inhibition(TetR_fc,LacI_fc)
)

Collection

Group together TopLevel objects

Usage: Requires no parameters but can reference n number of TopLevel objects with the member property.

Parameters

Name	Possible Values	Description

Specialised Components:

Description:
Groups together a set of TopLevel objects that have something in common. For example A set of Component objects representing a library of genetic logic gates.

Usage Example:

            # A Collection is a grouping of TopLevel objects.
# This example shows a collection of genetic logic gates.

AND_gate is a ModuleDefinition()
OR_gate is a ModuleDefinition()
NAND_gate is a ModuleDefinition()
NOR_gate is a ModuleDefinition()
XOR_gate is a ModuleDefinition()

genetic_logic_gates is a Collection()
(
  member = AND_gate
  member = OR_gate
  member = NAND_gate
  member = NOR_gate
  member = XOR_gate
)

hasSequence

Structure in Sequence format of parts of a design.

Usage: Given a Sequence in the from of a string ("ATCG" for example") define the hasSequence inside a ModuleDefinition.

Parameters

Name	Possible Values	Description
elements	- String	Characters that represents the constituents of a biological or chemical molecule
encoding	- i_iupacDNA - i_iupacRNA - i_iupacProtein - i_opensmilesSMILES	URI to indicate how theelements property of a Sequence MUST be formed and interpreted.

Specialised Components: - hasDNASequence - hasRNASequence - hasProteinSequence - hasChemicalStructure

Description:
Represent the primary structure of a Physical Part. Represent the primary structure of a ComponentDefinition object and the manner in which it is encoded.

Usage Example:

            # Sequences arent only DNA.

pTetR is a Promoter()
(
   hasDNASequence("tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac")
)

lacI_RBS is a RBS()
 
protein is a Protein()
(
  hasProteinSequence("AUG")
)

sequenceAnnotation

Describes regions of interest on a Sequence.

Usage: Given a ComponentDefinition and Location define the sequenceAnnotation inside a ComponentDefinition.

Parameters

Name	Possible Values	Description
componentDefinition	- Template	The substructure of the sequenceAnnotation in question
location	- Template	Location object toindicate which elements of a Sequence are described by the SequenceAnnotation.

Specialised Components:

Description:
This object essentially binds the Sequence to ComponentDefinition and is one of the methods to create sub-structures in ComponentDefinitions.

Usage Example:

            # SequenceAnnotations require a location object
# and componentDefinition defining what this actual location is.
# This allows definition of indication of phyisical location.

pTetR is a Promoter()
(
  hasDNASequence("tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac")
)
lacI_RBS is a RBS()


pTetR_loc is a InlineRange(1,55)
lacI_RBS_loc is a InlineRange(56,68)


tetRInverter is a DNAComponent()
(
  sequenceAnnotation(pTetR,pTetR_loc)
  sequenceAnnotation(lacI_RBS, lacI_RBS_loc)
)

sequenceConstraint

Assert restrictions on the relative, sequence-based positions of pairs sub parts.

Usage: Given a two sub-parts and a restriction type, define the sequenceConstraint inside a ComponentDefinition.

Parameters

Name	Possible Values	Description
componentDefinition	- Template	Subject part of constraint
componentDefinition	- Template	Object part of constraint
restriction	- i_precedes - i_sameOrientationAs - i_oppositeOrientationAs - i_differentFrom	type of restriction places on the ComponentDefinition.

Specialised Components: - precedes - sameOrientationAs - oppositeOrientationAs - differentFrom

Description:

Usage Example:

            # Says that the pTetR must be located 
# before the lacI_RBS.
# Unlike SeqAnno no exact location.

pTetR is a Promoter()
lacI_RBS is a RBS()

tetRInverter is a DNAComponent()
(
	precedes(pTetR,lacI_RBS)
)

subComponent

compose ComponentDefinition objects into a structural hierarchy.

Usage: Given a ComponentDefinition define the subCompponent inside a ComponentDefinition.

Parameters

Name	Possible Values	Description
componentDefinition	- Template	ComponentDefinition pertaining to sub part.

Specialised Components: - hasComponent - sequenceAnnotation - sequenceConstraint - precedes - sameOrientationAs - oppositeOrientationAs - differentFrom

Description:
Note This should only be used when you want to state a ComponentDefinition is a sub-component but it is not added to a sequenceConstraint or sequenceAnnotation.

Usage Example:

            # Says that pTetR is contained as a subsection of
# tetRInverter.
# This does not need to be defined when sequenceAnnotations
# or constraints are specified.
pTetR is a Promoter()

tetRInverter is a DNAComponent()
(
  subComponent(pTetR)
)

VariableComponent

A variable that changes during a CombinatorialDerivation.

Usage: Given a Component of the ComponentDefinition that is referenced by the template property reference the VariableComponent by the hasVariableComponent of the Parent CombinatorialDerivation.

Parameters

Name	Possible Values	Description
variable	- Template	A Component to serve as the template for the derivation of the new Component Object
cardinality	- URI	Specifies how many Component objects SHOULD be derived fromthe template Component during the derivation of a new ComponentDefinition.

Specialised Components: - ZeroOrOneVariableComponent - OneVariableComponent - ZeroPlusVariableComponent - OnePlusVariableComponent

Description:
Specifies a variable and set of values that will replace one of the Component objects in the template of a CombinatorialDerivation.

Usage Example:

            # VariableComponents are to be used exclusivley with CombinatorialDerivation.
# This exampele has a single gene with parts and each part is given as a VariableComponents.
# The variants are the alternative build parts in the CombinatorialDerivation.
# These variants can instead be Provided as Collections or other CombinatorialDerivation objects.
# See CombinatorialDerivation for the full example.

pTetR is a Promoter()
lacI_RBS is a RBS()
lacI_CDS is a CDS()
lacI_term is a Terminator()

pTetR_c is a Component(pTetR)
lacI_RBS_c is a Component(lacI_RBS)
lacI_CDS_c is a Component(lacI_CDS)
lacI_term_c is a Component(lacI_term)


promoter_variant_1 is a Promoter()
promoter_variant_2 is a Promoter()
rbs_variant_1 is a RBS()
rbs_variant_2 is a RBS()
cds_variant_1 is a CDS()
cds_variant_2 is a CDS()

tetRInverter is a DNA()
(
  component = pTetR_c
  component = lacI_RBS_c
  component = lacI_CDS_c
  component = lacI_term_c
)


pTetR_variable is a ZeroOrOneVariableComponent(pTetR_c)
(
  variant = promoter_variant_1
  variant = promoter_variant_2
)

lacI_RBS_variable is a OneVariableComponent(lacI_RBS_c)
(
  variant = rbs_variant_1
  variant = rbs_variant_2
)

lacI_CDS_variable is a ZeroPlusVariableComponent(lacI_CDS_c)
(
  variant = cds_variant_1
  variant = cds_variant_2
)

lacI_term_variable is a OnePlusVariableComponent(lacI_term_c)


laci_combinatorial_derivation is a CombinatorialDerivation(tetRInverter)
(
  variableComponent = pTetR_variable
  variableComponent = lacI_RBS_variable
  variableComponent = lacI_CDS_variable
  variableComponent = lacI_term_variable
)

Module

Occurance of a ModuleDefinition.

Usage: Given a ModuleDefinition, create Module and add to module property of the higher level ModuleDefinition.

Parameters

Name	Possible Values	Description
moduleDefinition	- Template	Blueprint ModuleDefinition.

Specialised Components:

Description:
Represents the usage or occurrence of a ModuleDefinition within a larger design (that is, another ModuleDefinition).

Usage Example:

            # Modules add heirachy / abstraction levels to ModuleDefinitions

sub_module_def is a ModuleDefinition()

template_module is a Module(sub_module_def)

module_def is a ModuleDefinition()
(
    module = template_module
)

ModuleDefinition

Group together entities.

Usage: No parameters required, properties are optional and can add any structural or functional enitites.

Parameters

Name	Possible Values	Description

Specialised Components:

Usage Example:

            # ModuleDefinitions can hold many
# templates as optional properties.

cas9_generic is a Protein()
gRNA_generic is a SGRNA()

cas9_generic_fc is a InOutComponent(cas9_generic)
gRNA_generic_fc is a InOutComponent(gRNA_generic)

cas9_generic_part is a Inhibitor(cas9_generic_fc)
gRNA_generic_part is a Inhibited(gRNA_generic_fc)
cas9_gRNA_int is a Inhibition()
(
	participation = cas9_generic_part
	participation = gRNA_generic_part	
)

ModuleDef_1 is a ModuleDefinition()
(
    functionalComponent = cas9_generic_fc
    functionalComponent = gRNA_generic_fc
    interaction = cas9_gRNA_int
)

hasModel

A template to hold external (non sbol_2 model).

Usage: Given a URI to a external model, definition of language and framework define the hasModel inside a ModuleDefinition.

Parameters

Name	Possible Values	Description
source	- URI	source
language	- i_SBML - i_CellML - i_BioPAX	URI that specifies the language in which the model is implemented
framework	- i_continuous - i_discrete	URI that specifies the framework in which the modei is implemented.

Specialised Components: - hasSBMLModel - hasCellMLModel - hasBioPAXModel

Description:
Provide additional meta-data to enable better reasoning about the contents of this model.

Usage Example:

            # Two models are written differently but 
# functionally identicial.

ModuleDef is a ModuleDefinition()
(
    hasSBMLModel(sbml_model,i_continuous)
    hasModel(sbml_model,i_SBML,i_continuous)
)

FAQ

Q. User or Developer Mode?
A. We would advise using User Mode, however this is entirely your choice both have advantages and disadvantages.

Q. What is the difference between using ComponentDefinition(i_DNA) and a specialised component such as DNA()
A. Nothing! Behind the scenes a specialised component does the same as explicitly definiing the type. It is advised to use the specialised components as it makes ShortBOL more readable.